Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06428

HP ID(1) HP06428
Gene ID(2) 8635
Gene Symbol finder RNASET2
Protein Name ribonuclease T2
RefSeq NM_003730.4
Length of RefSeq (bp) 1250
Chromosome 6q27
Reference DDBJ accession
UniGene Hs.529989

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi04G03 pGCAP10 GAGCAACGCGACTGACCGTGGTCGTGGGCGGACGGCGGCTGCAGCGTGNAGGAGCTGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl