Prev. |  KEGG KO K01166 > 

RIKEN DNA Bank Human Resource - RNASET2

Gene ID NCBI Gene 8635 |  KEGG hsa:8635
Gene Symbol RNASET2
Protein Name ribonuclease T2
Synonyms RNASE6PL|bA514O12.3
Ortholog resource in our bank

  RNASET2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032943 IRAK082F23 pCMV-SPORT6 BC039713 NM_003730 Full
HGX044092 IRAK110D20 pCMV-SPORT6 BC051912 NM_003730 Full
HGY081008 IRAL002I16 pOTB7 BC001660 NM_003730 Full
HGY084151 IRAL010G07 pOTB7 BC001819 NM_003730 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161747 ARi04G03 pGCAP10 NM_003730.4  
GAGCAACGCGACTGACCGTGGTCGTGGGCGGACGGCGGCTGCAGCGTGNAGGAGCTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl