Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06415

HP ID(1) HP06415
Gene ID(2) 5520
Gene Symbol finder PPP2R2A
Protein Name protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform
RefSeq NM_002717.2
Length of RefSeq (bp) 2385
Chromosome 8p21.2
Reference DDBJ accession
UniGene Hs.146339

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi02G01 pGCAP10 TGGAAATCTAGCATCCTGCCGGCTGGTCTGCCCGCCCCTCCTTCCTTTTCCCCCCGGCCC
RBd61H01 pGCAP10 GAGGCCAGCCGGCGCCATTTTGAAAGTGGAGTCGCCTGCCCCTGCCGCTGCCGCCGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl