Prev. |  Human A to Z list >  P >  PPP2R2A > 

NRCD Human cDNA Clone - ARi02G01

Ordering information ordering information
Catalog Number HKR160945
Clone Name ARi02G01
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) TGGAAATCTAGCATCCTGCCGGCTGGTCTGCCCGCCCCTCCTTCCTTTTCCCCCCGGCCC
Sequence, submitted(2) Not available.
Description Plasmid clone of human PPP2R2A cDNA with SV40 promoter
 
HP ID HP06415  finder other clones in this HP group.
Sequence, refered (NCBI RefSeq mRNA) NM_002717.2
Gene ID 5520
Gene Symbol PPP2R2A  finder other clones with this gene.
Synonyms B55A|B55ALPHA|PR52A|PR55A
Protein Name protein phosphatase 2, regulatory subunit B, alpha
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available. please download the data . Click below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARi02G01a.seq   ARi02G01c.seq   ARi02G01.pdf

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ).


2015.11.30

J:\Perl_src_\csv_set\NRCDhumcloneList_AR_140225.csv - GNP_filter3_NRCD_html_150711.pl