Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PPP2R2A

Gene ID (NCBI) 5520
Gene Symbol PPP2R2A
Protein Name protein phosphatase 2, regulatory subunit B, alpha
Synonyms B55A|B55ALPHA|PR52A|PR55A
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Hippo signaling (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04354)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY097897 IRAL044M09 pOTB7 BC041071 NM_002717 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR160945 ARi02G01 pGCAP10 NM_002717.2  
TGGAAATCTAGCATCCTGCCGGCTGGTCTGCCCGCCCCTCCTTCCTTTTCCCCCCGGCCC
HKR384569 RBd61H01 pGCAP10 NM_002717.2  
GAGGCCAGCCGGCGCCATTTTGAAAGTGGAGTCGCCTGCCCCTGCCGCTGCCGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl