Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06414

HP ID(1) HP06414
Gene ID(2) 10286
Gene Symbol finder BCAS2
Protein Name breast carcinoma amplified sequence 2
RefSeq NM_005872.2
Length of RefSeq (bp) 1310
Chromosome 1p21-p13.3
Reference DDBJ accession
UniGene Hs.22960

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi02F12 pGCAP10 GAAACGCAGGCAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTTGGTGGCTGGAGAGG
ARiS122P17 pGCAP10 GAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTTGGTGGCTGGAGAGGTTGTGGTGGA
RBdS105I16 pGCAP10 GGCAGGCAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTTGGTGGCTGGAGAGGTTGT
RBdS154L24 pGCAP10 CGGCCGGCCGATAGAAAACGCAGGCAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl