Prev. |  KEGG KO K12861 > 

RIKEN DNA Bank Human Resource - BCAS2

Gene ID NCBI Gene 10286 |  KEGG hsa:10286
Gene Symbol BCAS2
Protein Name BCAS2, pre-mRNA processing factor
Synonyms DAM1|SPF27|Snt309
Ortholog resources KEGG ortholog (KEGG orthology K12861) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086577 IRAL016H09 pDNR-LIB BC005285 NM_005872 Full
HGY087672 IRAL019C24 pDNR-LIB BC012623 NM_005872 Full
HGY095203 IRAL038A03 pDNR-LIB BC022880 NM_005872 Full
HGY096610 IRAL041I18 pDNR-LIB BC039238 NM_005872 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR160932 ARi02F12 pGCAP10 NM_005872.2  
GAAACGCAGGCAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTTGGTGGCTGGAGAGG
HKR249177 ARiS122P17 pGCAP10 NM_005872.2  
GAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTTGGTGGCTGGAGAGGTTGTGGTGGA
HKR442208 RBdS105I16 pGCAP10 NM_005872.2  
GGCAGGCAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTTGGTGGCTGGAGAGGTTGT
HKR461888 RBdS154L24 pGCAP10 NM_005872.2  
CGGCCGGCCGATAGAAAACGCAGGCAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl