Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105I16

Clone ID RBdS105I16
HP ID HP06414
Gene ID 10286
Gene Symbol BCAS2
Protein Name breast carcinoma amplified sequence 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005872.2
Length of RefSeq (bp) 1310
Chromosome 1p21-p13.3
Reference DDBJ accession
UniGene Hs.22960
5'-terminal sequence GGCAGGCAAACCTGAGGTCCTCAGAATGGCGGGCACAGGTTTGGTGGCTGGAGAGGTTGT
2011.08.28