Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06378

HP ID(1) HP06378
Gene ID(2) 22846
Gene Symbol finder VASH1
Protein Name vasohibin 1
RefSeq NM_014909.4
Length of RefSeq (bp) 6030
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.525479

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh11E04 pGCAP1 GGGACGGAGCGCATGCGCGGCGCGGGCCGGAGTCGAGCCTGGTGGGCGGCTGGCTGGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl