Prev. | 

RIKEN DNA Bank Human Resource - VASH1

Gene ID NCBI Gene 22846 |  KEGG hsa:22846
Gene Symbol VASH1
Protein Name vasohibin 1
Synonyms KIAA1036|TTCP 1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB08518 pcDNA3.1-mycHis-hVASH Expression construct of human VASH (KIAA1036) cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004886 IRAK012D14 pCMV-SPORT6 BC009031 NM_014909 Partial/var
HGX044037 IRAK110B13 pCMV-SPORT6 BC051896 NM_014909 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095237 M01C038B13 pDONR221 MGC08-G07 BC051896 ENST00000167106  
HGE095285 M01C038D13 pDONR221 MGC08-G07 BC051896 ENST00000167106  
HGE095333 M01C038F13 pDONR221 MGC08-G07 BC051896 ENST00000167106  
HGE095381 M01C038H13 pDONR221 MGC08-G07 BC051896 ENST00000167106  
HGE095429 M01C038J13 pDONR221 MGC08-G07 BC051896 ENST00000167106  
HGE095477 M01C038L13 pDONR221 MGC08-G07 BC051896 ENST00000167106  
HGE095525 M01C038N13 pDONR221 MGC08-G07 BC051896 ENST00000167106  
HGE095573 M01C038P13 pDONR221 MGC08-G07 BC051896 ENST00000167106  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR124500 ARh11E04 pGCAP1 NM_014909.4  
GGGACGGAGCGCATGCGCGGCGCGGGCCGGAGTCGAGCCTGGTGGGCGGCTGGCTGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl