Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06372

HP ID(1) HP06372
Gene ID(2) 22864
Gene Symbol finder R3HDM2
Protein Name R3H domain containing 2
RefSeq NM_014925.3
Length of RefSeq (bp) 3974
Chromosome 12q13.3
Reference DDBJ accession
UniGene Hs.443673

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi08B12 pGCAP10 GCCCCCTTTTCTCCCTTTCCGGGTTTGGTTCCCCCCTTTTCTTCCCCTCTCCCCCCTCCT
RBdS013K18 pGCAP10 GAAGAATACAGAATTTCAACAGAGGTTCATTCTCAAGAGAGATGATGCCAGTATGGACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl