Prev. | 

RIKEN DNA Bank Human Resource - R3HDM2

Gene ID NCBI Gene 22864 |  KEGG hsa:22864
Gene Symbol R3HDM2
Protein Name R3H domain containing 2
Synonyms CAG6|PR01365
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX007719 IRAK019E23 pCMV-SPORT6 BC008143 NM_014925 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163236 ARi08B12 pGCAP10 NM_014925.3  
GCCCCCTTTTCTCCCTTTCCGGGTTTGGTTCCCCCCTTTTCTTCCCCTCTCCCCCCTCCT
HKR405458 RBdS013K18 pGCAP10 NM_014925.3  
GAAGAATACAGAATTTCAACAGAGGTTCATTCTCAAGAGAGATGATGCCAGTATGGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl