Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06309

HP ID(1) HP06309
Gene ID(2) 221035
Gene Symbol finder REEP3
Protein Name receptor accessory protein 3
RefSeq NM_001001330.1
Length of RefSeq (bp) 2308
Chromosome 10q21.3
Reference DDBJ accession
UniGene Hs.499833

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi05H12 pGCAP10 GGGGCCGGCGGGCGGGGGCGGGCGGGGACGGGCGGGGGACGAAACGGACCCGNTCCTAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl