Prev. |  KEGG KO K17338 > 

RIKEN DNA Bank Human Resource - REEP3

Gene ID NCBI Gene 221035 |  KEGG hsa:221035
Gene Symbol REEP3
Protein Name receptor accessory protein 3
Synonyms C10orf74|Yip2b
Ortholog resource in our bank

  REEP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053335 IRAK133F15 pBluescript BC057832 NM_001001330 Partial/var
HGY067460 IRAK168K20 pBluescriptR BC068557 NM_001001330
HGY090945 IRAL027G01 pOTB7 BC010040 NM_001001330 Partial/var
HGY093036 IRAL032J20 pDNR-LIB BC018658 NM_001001330

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096809 M01C042A09 pDONR221 MGC10-E05 BC018658 NM_001001330  
HGE096857 M01C042C09 pDONR221 MGC10-E05 BC018658 NM_001001330  
HGE096905 M01C042E09 pDONR221 MGC10-E05 BC018658 NM_001001330  
HGE096953 M01C042G09 pDONR221 MGC10-E05 BC018658 NM_001001330  
HGE097001 M01C042I09 pDONR221 MGC10-E05 BC018658 NM_001001330  
HGE097049 M01C042K09 pDONR221 MGC10-E05 BC018658 NM_001001330  
HGE097097 M01C042M09 pDONR221 MGC10-E05 BC018658 NM_001001330  
HGE097145 M01C042O09 pDONR221 MGC10-E05 BC018658 NM_001001330  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162180 ARi05H12 pGCAP10 NM_001001330.1  
GGGGCCGGCGGGCGGGGGCGGGCGGGGACGGGCGGGGGACGAAACGGACCCGNTCCTAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl