Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06225

HP ID(1) HP06225
Gene ID(2) 771
Gene Symbol finder CA12
Protein Name carbonic anhydrase XII
RefSeq NM_001218.3
Length of RefSeq (bp) 3992
Chromosome 15q22
Reference DDBJ accession
UniGene Hs.210995

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb48A10 pGCAP1 GGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTGCGCGCATTCGGTCCCGGTTGTGCA
RBd34B12 pGCAP10 GGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTGCGCGCACGCGGTCCCGGTGTGCAG
RBdS040O23 pGCAP10 GGCTGCCCGGGGAAGCCAGGAGAGCGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTG
RBdS051I12 pGCAP10 GGCAGTGAGCCAAGACCATGCCACTGCATTTCAGCCTGTGCGACAGAGGGAGACTCCGTC
RBdS156K11 pGCAP10 GGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTGCGCGCACGCGGTCCCGGTGTGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl