Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156K11

Clone ID RBdS156K11
HP ID HP06225
Gene ID 771
Gene Symbol CA12
Protein Name carbonic anhydrase XII
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001218.3
Length of RefSeq (bp) 3992
Chromosome 15q22
Reference DDBJ accession
UniGene Hs.210995
5'-terminal sequence GGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTGCGCGCACGCGGTCCCGGTGTGCAG
2011.08.28