Prev. |  KEGG KO K01672 > 

RIKEN DNA Bank Human Resource - CA12

Gene ID NCBI Gene 771 |  KEGG hsa:771
Gene Symbol CA12
Protein Name carbonic anhydrase 12
Synonyms CA-XII|CAXII|HsT18816|T18816
Ortholog resource in our bank

  CA12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07599 pcDNA3.1(+)-hCA12

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082464 IRAL006C16 pOTB7 BC000278 NM_206925 Full
HGY090837 IRAL027B13 pOTB7 BC011691 NM_206925 Full
HGY092685 IRAL031L21 pDNR-LIB BC023981 NM_001218 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010247 W01A025K07 pENTR-TOPO flj0050p01 AK000158 NM_206925  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR339210 RBb48A10 pGCAP1 NM_001218.3  
GGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTGCGCGCATTCGGTCCCGGTTGTGCA
HKR373636 RBd34B12 pGCAP10 NM_001218.3  
GGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTGCGCGCACGCGGTCCCGGTGTGCAG
HKR416359 RBdS040O23 pGCAP10 NM_001218.3  
GGCTGCCCGGGGAAGCCAGGAGAGCGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTG
HKR420604 RBdS051I12 pGCAP10 NM_001218.3  
GGCAGTGAGCCAAGACCATGCCACTGCATTTCAGCCTGTGCGACAGAGGGAGACTCCGTC
HKR462651 RBdS156K11 pGCAP10 NM_001218.3  
GGAAGGGCGGACGTACTCGCCACGGCACCCAGGCTGCGCGCACGCGGTCCCGGTGTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl