Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06185

HP ID(1) HP06185
Gene ID(2) 5921
Gene Symbol finder RASA1
Protein Name RAS p21 protein activator (GTPase activating protein) 1
RefSeq NM_002890.1
Length of RefSeq (bp) 4307
Chromosome 5q13.3
Reference DDBJ accession
UniGene Hs.664080

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi14G04 pGCAP10 GACTCACTGAGAGCTCCAGGTAGTGAGCAGTTCAGTCGATTTCCTCGTTACCCCGCCCCC
RBb41F09 pGCAP1 AAATGTGACTGAGAGCTCCAGGTAGTGAGCAGTTCAGTCGATTTCCTCGTTACCCCGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl