Prev. |  KEGG KO K04352 > 

RIKEN DNA Bank Human Resource - RASA1

Gene ID NCBI Gene 5921 |  KEGG hsa:5921
Gene Symbol RASA1
Protein Name RAS p21 protein activator 1
Synonyms CM-AVM|CMAVM|CMAVM1|GAP|PKWS|RASA|RASGAP|p120|p120GAP|p120RASGAP
Featured content Axon guidance - human
Ortholog resource in our bank

  RASA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013728 IRAK034F08 pBluescriptR BC033015 NM_002890 Full
HGY099467 IRAL048L03 pDNR-LIB BC054891 NM_022650 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165748 ARi14G04 pGCAP10 NM_002890.1  
GACTCACTGAGAGCTCCAGGTAGTGAGCAGTTCAGTCGATTTCCTCGTTACCCCGCCCCC
HKR336529 RBb41F09 pGCAP1 NM_002890.1  
AAATGTGACTGAGAGCTCCAGGTAGTGAGCAGTTCAGTCGATTTCCTCGTTACCCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl