Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RASA1

Gene ID (NCBI) 5921
Gene Symbol RASA1
Protein Name RAS p21 protein activator 1
Synonyms CM-AVM|CMAVM|GAP|PKWS|RASA|RASGAP|p120|p120GAP|p120RASGAP
Databases KEGG hsa:5921 |  NCBI Gene 5921
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04352)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY013728 IRAK034F08 pBluescriptR BC033015 NM_002890 Full
HGY099467 IRAL048L03 pDNR-LIB BC054891 NM_022650 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165748 ARi14G04 pGCAP10 NM_002890.1  
GACTCACTGAGAGCTCCAGGTAGTGAGCAGTTCAGTCGATTTCCTCGTTACCCCGCCCCC
HKR336529 RBb41F09 pGCAP1 NM_002890.1  
AAATGTGACTGAGAGCTCCAGGTAGTGAGCAGTTCAGTCGATTTCCTCGTTACCCCGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl