Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06093

HP ID(1) HP06093
Gene ID(2) 5019
Gene Symbol finder OXCT1
Protein Name 3-oxoacid CoA transferase 1
RefSeq NM_000436.3
Length of RefSeq (bp) 3572
Chromosome 5p13.1
Reference DDBJ accession
UniGene Hs.278277

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe87D03 pKA1U5 GACATTTCCCAGCCAGAAAACTATCAGGAGTTTGTTCGGCTGCAGGGTGTGAAATTATTC
ARi18D05 pGCAP10 GGCAGTCGCGCACCGACGCTCAAACGCGCGCTCCAACCCGCAGCCTCCTCCTGCCTCACC
ARiS194D10 pGCAP10 GGCAGTCGCGCACCGACGCTCAAACGCGCGCTCCAACCCGCAGCCTCCTCCTGCCTCACC
RBd37C07 pGCAP10 GCTCCTCCTCCTGCCTCACCGCCCGAAGATGGCGGCTCTCAAACTCCTCTCCTCCGGGCT
RBdS105A07 pGCAP10 TTGGGACAGAGCCTCTTCTCCCCGCCGGGGCCCCGCCCAGCCTCACTTCTTTTAAAAGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl