Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105A07

Clone ID RBdS105A07
HP ID HP06093
Gene ID 5019
Gene Symbol OXCT1
Protein Name 3-oxoacid CoA transferase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000436.3
Length of RefSeq (bp) 3572
Chromosome 5p13.1
Reference DDBJ accession
UniGene Hs.278277
5'-terminal sequence TTGGGACAGAGCCTCTTCTCCCCGCCGGGGCCCCGCCCAGCCTCACTTCTTTTAAAAGCA
2011.08.28