Prev. |  KEGG KO K01027 > 

RIKEN DNA Bank Human Resource - OXCT1

Gene ID NCBI Gene 5019 |  KEGG hsa:5019
Gene Symbol OXCT1
Protein Name 3-oxoacid CoA-transferase 1
Synonyms OXCT|SCOT
Ortholog resource in our bank

  OXCT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007700 IRAK019E04 pCMV-SPORT6 BC009001 NM_000436 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074875 ARe87D03 pKA1U5 NM_000436.3  
GACATTTCCCAGCCAGAAAACTATCAGGAGTTTGTTCGGCTGCAGGGTGTGAAATTATTC
HKR167277 ARi18D05 pGCAP10 NM_000436.3  
GGCAGTCGCGCACCGACGCTCAAACGCGCGCTCCAACCCGCAGCCTCCTCCTGCCTCACC
HKR277682 ARiS194D10 pGCAP10 NM_000436.3  
GGCAGTCGCGCACCGACGCTCAAACGCGCGCTCCAACCCGCAGCCTCCTCCTGCCTCACC
HKR374855 RBd37C07 pGCAP10 NM_000436.3  
GCTCCTCCTCCTGCCTCACCGCCCGAAGATGGCGGCTCTCAAACTCCTCTCCTCCGGGCT
HKR442007 RBdS105A07 pGCAP10 NM_000436.3  
TTGGGACAGAGCCTCTTCTCCCCGCCGGGGCCCCGCCCAGCCTCACTTCTTTTAAAAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl