Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP06019

HP ID(1) HP06019
Gene ID(2) 22911
Gene Symbol finder WDR47
Protein Name WD repeat domain 47
RefSeq NM_014969.4
Length of RefSeq (bp) 4256
Chromosome 1p13.3
Reference DDBJ accession
UniGene Hs.654760

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb36B04 pGCAP1 GGCAGTCTGCAAGAGGCTGAGCTGANGAGTCGCTGGGCCGGGAGGGGCGGACGTGAGAAG
RBdS110P03 pGCAP10 GGCAGTCTGCAAGAGGCTGAGCTGAGGAGTCGCTGGGCCGGGAGGGGCGGACGTGAGAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl