Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110P03

Clone ID RBdS110P03
HP ID HP06019
Gene ID 22911
Gene Symbol WDR47
Protein Name WD repeat domain 47
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014969.4
Length of RefSeq (bp) 4256
Chromosome 1p13.3
Reference DDBJ accession
UniGene Hs.654760
5'-terminal sequence GGCAGTCTGCAAGAGGCTGAGCTGAGGAGTCGCTGGGCCGGGAGGGGCGGACGTGAGAAG
2011.08.28