Prev. | 

RIKEN DNA Bank Human Resource - WDR47

Gene ID NCBI Gene 22911 |  KEGG hsa:22911
Gene Symbol WDR47
Protein Name WD repeat domain 47
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013367 IRAK033G23 pBluescriptR BC034964 NM_014969 Full
HGY019434 IRAK048J18 pBluescriptR BC039254 NM_014969 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090034 M01C025B10 pDONR221 MGC02-D05 BC039254 ENST00000361054  
HGE090082 M01C025D10 pDONR221 MGC02-D05 BC039254 ENST00000361054  
HGE090130 M01C025F10 pDONR221 MGC02-D05 BC039254 ENST00000361054  
HGE090178 M01C025H10 pDONR221 MGC02-D05 BC039254 ENST00000361054  
HGE090226 M01C025J10 pDONR221 MGC02-D05 BC039254 ENST00000361054  
HGE090274 M01C025L10 pDONR221 MGC02-D05 BC039254 ENST00000361054  
HGE090322 M01C025N10 pDONR221 MGC02-D05 BC039254 ENST00000361054  
HGE090370 M01C025P10 pDONR221 MGC02-D05 BC039254 ENST00000361054  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR334428 RBb36B04 pGCAP1 NM_014969.4  
GGCAGTCTGCAAGAGGCTGAGCTGANGAGTCGCTGGGCCGGGAGGGGCGGACGTGAGAAG
HKR444363 RBdS110P03 pGCAP10 NM_014969.4  
GGCAGTCTGCAAGAGGCTGAGCTGAGGAGTCGCTGGGCCGGGAGGGGCGGACGTGAGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl