Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05984

HP ID(1) HP05984
Gene ID(2) 10432
Gene Symbol finder RBM14
Protein Name RNA binding motif protein 14
RefSeq NM_006328.3
Length of RefSeq (bp) 5415
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.648833

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd18H07 pGCAP10 GGGACGTCTTGCCTGTCGCTGGAGGAGAGGTCCGGGCTCTCCAGGAAGGTGGCTGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl