Prev. |  KEGG KO K13189 > 

RIKEN DNA Bank Human Resource - RBM14

Gene ID NCBI Gene 10432 |  KEGG hsa:10432
Gene Symbol RBM14
Protein Name RNA binding motif protein 14
Synonyms COAA|PSP2|SIP|SYTIP1|TMEM137
Ortholog resource in our bank

  RBM14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080440 IRAL001B16 pOTB7 BC000488 NM_006328 Full
HGY089407 IRAL023I15 pOTB7 BC007641 NM_032886 Full
HGY096021 IRAL040A21 pOTB7 BC024260 NM_032886 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR367375 RBd18H07 pGCAP10 NM_006328.3  
GGGACGTCTTGCCTGTCGCTGGAGGAGAGGTCCGGGCTCTCCAGGAAGGTGGCTGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl