Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05943

HP ID(1) HP05943
Gene ID(2) 54700
Gene Symbol finder RRN3
Protein Name RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
RefSeq NM_018427.3
Length of RefSeq (bp) 3762
Chromosome 16p12
Reference DDBJ accession
UniGene Hs.460078

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd13C08 pGCAP10 GGGGCATCCGGCCTGAGGCGCAGCGGTCGCGTTAGTTCGGCCCAATGGCGGCACCGCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl