Prev. |  KEGG KO K15216 > 

RIKEN DNA Bank Human Resource - RRN3

Gene ID NCBI Gene 54700 |  KEGG hsa:54700
Gene Symbol RRN3
Protein Name RRN3 homolog, RNA polymerase I transcription factor
Synonyms A-270G1.2|TIFIA
Ortholog resource in our bank

  RRN3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY025542 IRAK063O06 pBluescriptR BC036182 NM_018427 Full/var
HGY089854 IRAL024K14 pOTB7 BC009198 NM_018427 Partial/var
HGY101739 IRAL054F19 pOTB7 BC068999 NM_018427 Partial/var
HGY103442 IRAL058K02 pOTB7 BC071868 NM_018427 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365256 RBd13C08 pGCAP10 NM_018427.3  
GGGGCATCCGGCCTGAGGCGCAGCGGTCGCGTTAGTTCGGCCCAATGGCGGCACCGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl