Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05871

HP ID(1) HP05871
Gene ID(2) 201161
Gene Symbol finder PRR6
Protein Name proline rich 6
RefSeq NM_181716.2
Length of RefSeq (bp) 1181
Chromosome 17p11.2
Reference DDBJ accession
UniGene Hs.433422

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb29D04 pGCAP1 GGCCAGGCTGCGGGAGCCATGCGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGG
RBb31A12 pGCAP1 GAGGCTGCGGGAGCCATGCCGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCA
RBd35C03 pGCAP10 GGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAGAAGCGGTCCGGGGCCTCCGGG
RBd48C10 pGCAP10 GAGGCTGCGGGAGCCATGCGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAG
RBd71D09 pGCAP10 GGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAGAAGCGGTCCGGGGCCTCC
RBd82F01 pGCAP10 GGGGCGCGCCGCGCTGCGAGGCCTGCGCGCCAGGCTGCGGGAGCCATGCGGNGATCNAGG
RBd84A01 pGCAP10 GAGAAGCGGTCCGGGGCCTCCGCGGCCCCCGCGGCCTCCGCGGCCGCTGCCTTGGCACCC
RBdS007M24 pGCAP10 TGGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAGAAGCGGTCCGGGGCCTCCGCGGCC
RBdS081L11 pGCAP10 GGAGCTCTGCNNCCNCCNANCTGCGCNGNCANAANCGGNNCGGGGCCTCCGGGGNCNCCG
RBdS132F05 pGCAP10 GCTCCGCGGCCGCTGCCTTGGCACCCAGCGCCACCCGCACACGGCGCTCCGCTAGCCAGG
RBdS156B06 pGCAP10 GGGTCCGGGGCCTCCGCGGCCCCCGCGGCCTCCGCGGCCGCTGCCTTGGCACCCAGCGCC
RBdS187O16 pGCAP10 GGCTGCGAGGCCTGCGCGCCAGGCTGCGGGAGCCATGCGGCGATCGAGGAGCTCTGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl