Prev. | 

RIKEN DNA Bank Human Resource - CENPV

Gene ID NCBI Gene 201161 |  KEGG hsa:201161
Gene Symbol CENPV
Protein Name centromere protein V
Synonyms 3110013H01Rik|CENP-V|PRR6|p30
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY098940 IRAL047F20 pOTB7 BC052604 NM_181716 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE104843 M01C062B19 pDONR221 06_05-G10 BC052604 NM_181716  
HGE104891 M01C062D19 pDONR221 06_05-G10 BC052604 NM_181716  
HGE104939 M01C062F19 pDONR221 06_05-G10 BC052604 NM_181716  
HGE104987 M01C062H19 pDONR221 06_05-G10 BC052604 NM_181716  
HGE105035 M01C062J19 pDONR221 06_05-G10 BC052604 NM_181716  
HGE105083 M01C062L19 pDONR221 06_05-G10 BC052604 NM_181716  
HGE105131 M01C062N19 pDONR221 06_05-G10 BC052604 NM_181716  
HGE105179 M01C062P19 pDONR221 06_05-G10 BC052604 NM_181716  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR331676 RBb29D04 pGCAP1 NM_181716.2  
GGCCAGGCTGCGGGAGCCATGCGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGG
HKR332412 RBb31A12 pGCAP1 NM_181716.2  
GAGGCTGCGGGAGCCATGCCGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCA
HKR374051 RBd35C03 pGCAP10 NM_181716.2  
GGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAGAAGCGGTCCGGGGCCTCCGGG
HKR379258 RBd48C10 pGCAP10 NM_181716.2  
GAGGCTGCGGGAGCCATGCGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAG
HKR388481 RBd71D09 pGCAP10 NM_181716.2  
GGGCGATCGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAGAAGCGGTCCGGGGCCTCC
HKR392921 RBd82F01 pGCAP10 NM_181716.2  
GGGGCGCGCCGCGCTGCGAGGCCTGCGCGCCAGGCTGCGGGAGCCATGCGGNGATCNAGG
HKR393601 RBd84A01 pGCAP10 NM_181716.2  
GAGAAGCGGTCCGGGGCCTCCGCGGCCCCCGCGGCCTCCGCGGCCGCTGCCTTGGCACCC
HKR403112 RBdS007M24 pGCAP10 NM_181716.2  
TGGAGGAGCTCTGCGGCCGCCAAGCTGCGCGGGCAGAAGCGGTCCGGGGCCTCCGCGGCC
HKR432675 RBdS081L11 pGCAP10 NM_181716.2  
GGAGCTCTGCNNCCNCCNANCTGCGCNGNCANAANCGGNNCGGGGCCTCCGGGGNCNCCG
HKR452925 RBdS132F05 pGCAP10 NM_181716.2  
GCTCCGCGGCCGCTGCCTTGGCACCCAGCGCCACCCGCACACGGCGCTCCGCTAGCCAGG
HKR462430 RBdS156B06 pGCAP10 NM_181716.2  
GGGTCCGGGGCCTCCGCGGCCCCCGCGGCCTCCGCGGCCGCTGCCTTGGCACCCAGCGCC
HKR475152 RBdS187O16 pGCAP10 NM_181716.2  
GGCTGCGAGGCCTGCGCGCCAGGCTGCGGGAGCCATGCGGCGATCGAGGAGCTCTGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl