Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156B06

Clone ID RBdS156B06
HP ID HP05871
Gene ID 201161
Gene Symbol PRR6
Protein Name proline rich 6
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_181716.2
Length of RefSeq (bp) 1181
Chromosome 17p11.2
Reference DDBJ accession
UniGene Hs.433422
5'-terminal sequence GGGTCCGGGGCCTCCGCGGCCCCCGCGGCCTCCGCGGCCGCTGCCTTGGCACCCAGCGCC
2011.08.28