Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05861

HP ID(1) HP05861
Gene ID(2) 1690
Gene Symbol finder COCH
Protein Name coagulation factor C homolog, cochlin (Limulus polyphemus)
RefSeq NM_004086.1
Length of RefSeq (bp) 2534
Chromosome 14q12-q13
Reference DDBJ accession
UniGene Hs.21016

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb28B12 pGCAP1 GGCACTCGGGCGCAGCCGGGTGGATCTCGAGCAGCTCCCATTGCTATCACATGTTTTACC
RBdS015L03 pGCAP10 GGCACTCGGGCGCAGCCGGGTGGATCTCGAGCAGGTGCGGAGCCCCGGGCGGCGGGCGCG
RBdS040D03 pGCAP10 GGCACTCGGGCGCAGCCGGGTGGATCTCGAGCAGGTGCGGAGCCCCGGGCGGCGGGCGCG
RBdS177E02 pGCAP10 TGGCTTTATAGCGGCCGCGGGGGCCTTGCCTTCCGCACTCGGGCGCAGCCGGGTGGATCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl