Prev. | 

RIKEN DNA Bank Human Resource - COCH

Gene ID NCBI Gene 1690 |  KEGG hsa:1690
Gene Symbol COCH
Protein Name cochlin
Synonyms COCH-5B2|COCH5B2|DFNA9|DFNB110
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088814 IRAL022A14 pOTB7 BC007230 NM_004086 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331236 RBb28B12 pGCAP1 NM_004086.1  
GGCACTCGGGCGCAGCCGGGTGGATCTCGAGCAGCTCCCATTGCTATCACATGTTTTACC
HKR406267 RBdS015L03 pGCAP10 NM_004086.1  
GGCACTCGGGCGCAGCCGGGTGGATCTCGAGCAGGTGCGGAGCCCCGGGCGGCGGGCGCG
HKR416075 RBdS040D03 pGCAP10 NM_004086.1  
GGCACTCGGGCGCAGCCGGGTGGATCTCGAGCAGGTGCGGAGCCCCGGGCGGCGGGCGCG
HKR470898 RBdS177E02 pGCAP10 NM_004086.1  
TGGCTTTATAGCGGCCGCGGGGGCCTTGCCTTCCGCACTCGGGCGCAGCCGGGTGGATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl