Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177E02

Clone ID RBdS177E02
HP ID HP05861
Gene ID 1690
Gene Symbol COCH
Protein Name coagulation factor C homolog, cochlin (Limulus polyphemus)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004086.1
Length of RefSeq (bp) 2534
Chromosome 14q12-q13
Reference DDBJ accession
UniGene Hs.21016
5'-terminal sequence TGGCTTTATAGCGGCCGCGGGGGCCTTGCCTTCCGCACTCGGGCGCAGCCGGGTGGATCT
2011.08.28