Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05854

HP ID(1) HP05854
Gene ID(2) 146713
Gene Symbol finder RBFOX3
Protein Name RNA binding protein, fox-1 homolog (C. elegans) 3
RefSeq NM_001082575.1
Length of RefSeq (bp) 2696
Chromosome 17q25.3
Reference DDBJ accession
UniGene Hs.135229

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb27C07 pGCAP1 GCCGCCTCTGCGCCGCCGCCGCCACCGGTGGCCCCCGCTGCGCTCCCCGCGTCATGGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl