Prev. |  KEGG KO K14946 > 

RIKEN DNA Bank Human Resource - RBFOX3

Gene ID NCBI Gene 146713 |  KEGG hsa:146713
Gene Symbol RBFOX3
Protein Name RNA binding fox-1 homolog 3
Synonyms FOX-3|FOX3|HRNBP3|NEUN
Ortholog resources KEGG ortholog (KEGG orthology K14946) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR330855 RBb27C07 pGCAP1 NM_001082575.1  
GCCGCCTCTGCGCCGCCGCCGCCACCGGTGGCCCCCGCTGCGCTCCCCGCGTCATGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl