Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05826

HP ID(1) HP05826
Gene ID(2) 7374
Gene Symbol finder UNG
Protein Name uracil-DNA glycosylase
RefSeq NM_003362.2
Length of RefSeq (bp) 2081
Chromosome 12q23-q24.1
Reference DDBJ accession
UniGene Hs.191334

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb23E10 pGCAP1 GGGGCCGCTTGGCGCCAATTGCTGACCGCCACAGCCACAGCCAGGGCTAGCCTCGCCGGT
RBd46C04 pGCAP10 GGGAGTTCGGGAAACCGTATTTTATCAAGCTAATGGGATTTGTTGCAGAAGAAAGAAAGC
RBd95H04 pGCAP10 GGACCGCCACAGCCACAGCCAGGGCTAGCCTCGCCGGTTCCCGGGTGGCGCGCGTTCGCT
RBdS014K11 pGCAP10 GGCCAATTGCTGACCGCCACAGCCACAGCCAGGGCTAGCCTCGCCGGTTCCCGGGTGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl