Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014K11

Clone ID RBdS014K11
HP ID HP05826
Gene ID 7374
Gene Symbol UNG
Protein Name uracil-DNA glycosylase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003362.2
Length of RefSeq (bp) 2081
Chromosome 12q23-q24.1
Reference DDBJ accession
UniGene Hs.191334
5'-terminal sequence GGCCAATTGCTGACCGCCACAGCCACAGCCAGGGCTAGCCTCGCCGGTTCCCGGGTGGCG
2011.08.28