Prev. |  KEGG KO K03648 > 

RIKEN DNA Bank Human Resource - UNG

Gene ID NCBI Gene 7374 |  KEGG hsa:7374
Gene Symbol UNG
Protein Name uracil DNA glycosylase
Synonyms DGU|HIGM4|HIGM5|UDG|UNG1|UNG15|UNG2
Ortholog resources KEGG ortholog (KEGG orthology K03648) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044344 IRAK110O08 pCMV-SPORT6 BC050634 NM_003362 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR329306 RBb23E10 pGCAP1 NM_003362.2  
GGGGCCGCTTGGCGCCAATTGCTGACCGCCACAGCCACAGCCAGGGCTAGCCTCGCCGGT
HKR378452 RBd46C04 pGCAP10 NM_003362.2  
GGGAGTTCGGGAAACCGTATTTTATCAAGCTAATGGGATTTGTTGCAGAAGAAAGAAAGC
HKR398172 RBd95H04 pGCAP10 NM_003362.2  
GGACCGCCACAGCCACAGCCAGGGCTAGCCTCGCCGGTTCCCGGGTGGCGCGCGTTCGCT
HKR405851 RBdS014K11 pGCAP10 NM_003362.2  
GGCCAATTGCTGACCGCCACAGCCACAGCCAGGGCTAGCCTCGCCGGTTCCCGGGTGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl