Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05818

HP ID(1) HP05818
Gene ID(2) 80381
Gene Symbol finder CD276
Protein Name CD276 molecule
RefSeq NM_001024736.1
Length of RefSeq (bp) 3419
Chromosome 15q23-q24
Reference DDBJ accession
UniGene Hs.77873

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109H02 pGCAP10 GATTCGGGCCGGGCCTCGCTGCGGCGGCGACTGAGCCAGGCTGGGCCGCGTCCCTGAGTC
RBdS075P20 pGCAP10 GAGGCCTCGGTCAGCAGCCGCCACCGCGGGGCCAATCCGGCCTCAGGGACGCACCGGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl