Prev. |  KEGG KO K06746 > 

RIKEN DNA Bank Human Resource - CD276

Gene ID NCBI Gene 80381 |  KEGG hsa:80381
Gene Symbol CD276
Protein Name CD276 molecule
Synonyms 4Ig-B7-H3|B7-H3|B7H3|B7RP-2
Ortholog resource in our bank

  CD276

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07596 pcDNA3.1(+) human B7-H3 Expression vector of human B7-H3

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX054159 IRAK135G15 pCMV-SPORT6 BC062581 NM_025240 Partial/var
HGY091609 IRAL029A09 pOTB7 BC011578 NM_025240 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082015 M01C005A15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE082063 M01C005C15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE082111 M01C005E15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE082159 M01C005G15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE082207 M01C005I15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE082255 M01C005K15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE082303 M01C005M15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE082351 M01C005O15 pDONR221 04-134-2_3-A08 AK075549 NM_001024736  
HGE085247 M01C013B23 pDONR221 FLJ04-C12 AK075549 NM_001024736  
HGE085295 M01C013D23 pDONR221 FLJ04-C12 AK075549 NM_001024736  
HGE085343 M01C013F23 pDONR221 FLJ04-C12 AK075549 NM_001024736  
HGE085391 M01C013H23 pDONR221 FLJ04-C12 AK075549 NM_001024736  
HGE085439 M01C013J23 pDONR221 FLJ04-C12 AK075549 NM_001024736  
HGE085487 M01C013L23 pDONR221 FLJ04-C12 AK075549 NM_001024736  
HGE085535 M01C013N23 pDONR221 FLJ04-C12 AK075549 NM_001024736  
HGE085583 M01C013P23 pDONR221 FLJ04-C12 AK075549 NM_001024736  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243770 ARiS109H02 pGCAP10 NM_001024736.1  
GATTCGGGCCGGGCCTCGCTGCGGCGGCGACTGAGCCAGGCTGGGCCGCGTCCCTGAGTC
HKR430380 RBdS075P20 pGCAP10 NM_001024736.1  
GAGGCCTCGGTCAGCAGCCGCCACCGCGGGGCCAATCCGGCCTCAGGGACGCACCGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl