Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075P20

Clone ID RBdS075P20
HP ID HP05818
Gene ID 80381
Gene Symbol CD276
Protein Name CD276 molecule
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001024736.1
Length of RefSeq (bp) 3419
Chromosome 15q23-q24
Reference DDBJ accession
UniGene Hs.77873
5'-terminal sequence GAGGCCTCGGTCAGCAGCCGCCACCGCGGGGCCAATCCGGCCTCAGGGACGCACCGGAGC
2011.08.28