Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05814

HP ID(1) HP05814
Gene ID(2) 221927
Gene Symbol finder C7orf27
Protein Name chromosome 7 open reading frame 27
RefSeq NM_152743.2
Length of RefSeq (bp) 2713
Chromosome 7p22.2
Reference DDBJ accession
UniGene Hs.520623

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb39G12 pGCAP1 GGGACGCAACCGAGCGGGCCTGCGGCCTCACCATGGACCCAGAATGCGCCCAGCTGCTCC
RBb69B02 pGCAP1 GGGGCGAGGGGTGGTTGCGGCGGAGGACGCAACCGAGCGGGCCTGCGGCCTCACCATGGA
RBd59H06 pGCAP10 GGGGCGAGGGGTGGTTGCGGCGGAGGACGCAACCGAGCGGGCCTGCGGCCTCACCATGGA
RBdS040L01 pGCAP10 GAACCGAGCGGTGAGGGCCTGCGGCCTCACCATGGACCCAGAATGCGCCCAGCTGCTCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl