Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040L01

Clone ID RBdS040L01
HP ID HP05814
Gene ID 221927
Gene Symbol C7orf27
Protein Name chromosome 7 open reading frame 27
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_152743.2
Length of RefSeq (bp) 2713
Chromosome 7p22.2
Reference DDBJ accession
UniGene Hs.520623
5'-terminal sequence GAACCGAGCGGTGAGGGCCTGCGGCCTCACCATGGACCCAGAATGCGCCCAGCTGCTCCC
2011.08.28