Prev. | 

RIKEN DNA Bank Human Resource - BRAT1

Gene ID NCBI Gene 221927 |  KEGG hsa:221927
Gene Symbol BRAT1
Protein Name BRCA1 associated ATM activator 1
Synonyms BAAT1|C7orf27|NEDCAS|RMFSL
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088817 IRAL022A17 pOTB7 BC007209 NM_152743 Partial
HGY091379 IRAL028H11 pOTB7 BC023561 NM_152743 Partial
HGY093216 IRAL033A16 pOTB7 BC015632 NM_152743

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081615 M01C004A15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE081663 M01C004C15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE081711 M01C004E15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE081759 M01C004G15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE081807 M01C004I15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE081855 M01C004K15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE081903 M01C004M15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE081951 M01C004O15 pDONR221 04-134-2_2-E08 BC015632 ENST00000340611  
HGE100436 M01C051B12 pDONR221 MGC15-D06 BC015632 ENST00000340611  
HGE100484 M01C051D12 pDONR221 MGC15-D06 BC015632 ENST00000340611  
HGE100532 M01C051F12 pDONR221 MGC15-D06 BC015632 ENST00000340611  
HGE100580 M01C051H12 pDONR221 MGC15-D06 BC015632 ENST00000340611  
HGE100628 M01C051J12 pDONR221 MGC15-D06 BC015632 ENST00000340611  
HGE100676 M01C051L12 pDONR221 MGC15-D06 BC015632 ENST00000340611  
HGE100724 M01C051N12 pDONR221 MGC15-D06 BC015632 ENST00000340611  
HGE100772 M01C051P12 pDONR221 MGC15-D06 BC015632 ENST00000340611  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR335756 RBb39G12 pGCAP1 NM_152743.2  
GGGACGCAACCGAGCGGGCCTGCGGCCTCACCATGGACCCAGAATGCGCCCAGCTGCTCC
HKR347626 RBb69B02 pGCAP1 NM_152743.2  
GGGGCGAGGGGTGGTTGCGGCGGAGGACGCAACCGAGCGGGCCTGCGGCCTCACCATGGA
HKR383774 RBd59H06 pGCAP10 NM_152743.2  
GGGGCGAGGGGTGGTTGCGGCGGAGGACGCAACCGAGCGGGCCTGCGGCCTCACCATGGA
HKR416265 RBdS040L01 pGCAP10 NM_152743.2  
GAACCGAGCGGTGAGGGCCTGCGGCCTCACCATGGACCCAGAATGCGCCCAGCTGCTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl