Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05809

HP ID(1) HP05809
Gene ID(2) 8241
Gene Symbol finder RBM10
Protein Name RNA binding motif protein 10
RefSeq NM_005676.3
Length of RefSeq (bp) 3415
Chromosome Xp11.23
Reference DDBJ accession
UniGene Hs.401509

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd50C06 pGCAP10 CGGCCGGCCGATGCTCCCTTCTCGTCGTCGCCATTTTGAGCTGGTGACTGTGGCCGGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl