Prev. |  KEGG KO K13094 > 

RIKEN DNA Bank Human Resource - RBM10

Gene ID NCBI Gene 8241 |  KEGG hsa:8241
Gene Symbol RBM10
Protein Name RNA binding motif protein 10
Synonyms DXS8237E|GPATC9|GPATCH9|S1-1|TARPS|ZRANB5
Ortholog resource in our bank

  RBM10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081066 IRAL002L02 pOTB7 BC004181 NM_005676 Full
HGY082232 IRAL005J16 pOTB7 BC000681 NM_152856 Partial/var
HGY082299 IRAL005M11 pOTB7 BC008733 NM_005676 Full
HGY083323 IRAL008F03 pOTB7 BC003089 NM_152856 Full
HGY090041 IRAL025B17 pOTB7 BC024153 NM_005676 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR380054 RBd50C06 pGCAP10 NM_005676.3  
CGGCCGGCCGATGCTCCCTTCTCGTCGTCGCCATTTTGAGCTGGTGACTGTGGCCGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl