Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05779

HP ID(1) HP05779
Gene ID(2) 125988
Gene Symbol finder C19orf70
Protein Name chromosome 19 open reading frame 70
RefSeq NM_205767.1
Length of RefSeq (bp) 943
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.356626

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb44F05 pGCAP1 GGCGCGTGGATCCGAGCGACCATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTCATC
RBd72B12 pGCAP10 GGCGCGTGGATCCGAGCGACCATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTCATC
RBd85H03 pGCAP10 GGACAGGAAGCGGCGGGCGAGCCGAGTGTCCTTGCGCGTGGATCCGAGCGACCATGGTGG
RBdS081G10 pGCAP10 GCTTGCGCGTGGATCCGAGCGACCATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl