Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081G10

Clone ID RBdS081G10
HP ID HP05779
Gene ID 125988
Gene Symbol C19orf70
Protein Name chromosome 19 open reading frame 70
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_205767.1
Length of RefSeq (bp) 943
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.356626
5'-terminal sequence GCTTGCGCGTGGATCCGAGCGACCATGGTGGCCCGGGTGTGGTCGCTGATGAGGTTCCTC
2011.08.28